Publish - DNA Sequence Publishing Tool

Instructions: Paste a sequence into the text area at the top of this applet.

 Fromat control legend --

    a) number line          :                10 
    b) dot scale line       :                 .         .
    c) the sequence itself  :        GAATTCACGATCGATCGTAG
    D) dash scale line      :     1  ---------+---------+  20
    e) the complement       :        CTTAAGTGCTAGCTAGCATC
    f) 3 letter translation :        GluPheThrIleAspArg
    g) 1 Letter translation :        E  F  T  I  D  R
    h) Centered under codon :         E  F  T  I  D  R 
    i) blank line           :

  Using an uppercase characer will number this line along the edges.